Tuesday, November 18, 2014

The Hoax

      










                   


            In 1912, Charles Dawson (an amateur archaeologist) conducted a hand-dig at a gravel pit in Piltdown, a little village in England. Dawson had found what he claimed to be the fossilized remains of a human skull. Dawson then had invited Arthur Woodward, a leading geologist from the Natural History Museum, and Father Pierre Teilhard de Chardin, a French paleontologist, to join his dig at Piltdown. Through that summer, they made what was deemed "astonishing finds." There, Charles Dawson found a sensational jawbone fossil he claimed belonged to the ancient piece of human skull he had discovered previously.

 In 1917 Dawson discovered another skull and tooth, labeled "Piltdown Man Two" this was taken as additional evidence that his discoveries were legitimate. This jawbone did not look to be human, but something closer to an ape in structure. The teeth implied human characteristics, as they were ground into the shape of human molars, from grinding and crushing food over time. The find was incredible, for the time, and caused a lot of excitement in the field of science. It was viewed as the "rarest and most treasured find" of paleontology, and seemed to express some kind of evolutionary connection between apes and humans backing the theory of evolution, and even more so proving the theory of evolution to be true, by providing the trunk between the roots and the branches.  In England, it was widely celebrated by the scientific community because (finally) there was evidence that England had ancient human remains just as France, Germany, and Asia. What was particularly important to England was the fact that these remains dubbed the "Piltdown Man"might even be the oldest human remains found to date.

With assertion from England's leading anatomist, Arthur Keith, the discovery of the jaw and skull bones appeared to support the theory that the development of large brains came before the development of upright walking in human evolution. This was extraordinarily important to the field of science and to the field of human evolution. The findings of fossilized remains continued unchallenged until the death of Charles Dawson in 1916.

Contradicting evidence to the findings of Piltdown Man began appearing in the 1920's when, in places like Asia and Africa, where a number of ancient human remains began to be discovered. The contradicting evidence came in the fact that the newly discovered human remains were not as old as Piltdown Man, but was far less human. At that time there was insufficient technology to distinguish whether the remains of Piltdown Man were just a bizarre phenomenon in human evolution or a hoax.

In 1949 new technology allowed for a better method of dating the remains by measuring the fluorine content of the fossils. This method of chemical analysis had been devised in 1939 by Kenneth Oakley. Oakley found that Fossils absorb fluorine from the soil and water around them, so fossils found in the same area should be around the same age.  10 years after its discovery, Oakley was able to use the measurement of fluorine to reveal that the fossilized remains that were considerably younger than previously proclaimed (50,000 vs. 500,000), thus further confusing the scientific community.

          Then in 1953, after World War ll technology advanced to where scientists could date the remains and they found that they were much younger than expected and that the remains had been found to be tampered with.  The jaw bones were an easy give away that it was an Orangutan jaw had been removed, the teeth had been filed, and the fossil had been stained to make it appear older than it actually was.  Scientists were shocked and in the fields of human evolution further discovered telltale signs that this was certainly a hoax.  The scientists in this field have reacted by being aware that these hoaxes are certainly possible and to watch out for foul play. It was deemed the fossilized jawbone had been stained to appear older, and pieces of the bone had been cut off after fossilization. Additionally, the teeth had been filed down to resemble human molars. The jawbone actually belonged to a female orangutan less than a hundred years old, but pieces of the jaw that would have indicated this were broken off. In 1959 Carbon-14 dating became available and it was then revealed that the skullcap "fossils" were only about 1,000 years old and were really just old bones.

This physical evidence was very important to the field of evolution, and more solid than the circumstantial evidence. Scientists were shocked that this could happen, but it brought to light that scientists are human, subject to pride and self-interest, and are capable of lying to further their careers as seen in the particular case of Piltdown. It had previously been thought that scientists would not provide false science, but it happened, and now scientists are more scrutinized in their analysis of scientific evidence. Unfortunately, this gives further strength to groups that are against science, and specifically against evolution. It can now be argued, that scientists lie and therefore all scientific evidence cannot be taken as fact until verified by a second source.

I don’t believe that it’s possible to remove the “human nature” factor from science because humans propose new theories from their discoveries. Even though the theory might be false at first but it is natural for humans establish a hypothesis through trial and error. There will likely always be someone who revisits the theory that can prove, disprove, or improve it.



I have learned that it is important to question things when in doubt, not taking everything at face-value, especially important discoveries such as the "Piltdown Man". Discoveries should be carefully analyzed by multiple scientists that can assist in concluding a reliable theory. From the” Piltdown Man” hoax, a lot can be learned in regards to using verified sources. Maybe if the scientists in England in the early 1900's had taken their own skepticism more seriously, they would have been more resourceful and determined in their evaluation of the Piltdown Man remains it would have revealed it as a hoax sooner than 40 years later.


Wednesday, November 12, 2014

Primate Comparison - Week 4

Primate Comparison Week 4
When comparing the social and mating patterns of lemurs, spider monkeys, baboons, gibbons, and chimpanzees will gain one an evolutionary viewpoint by using the behavioral ecology approach. One must first do a thorough investigation of the environment in which the primates live is needed to understand behavioral: social and mating patterns.

Lemurs (Prosimians/Strepsirhini)
Lemurs occupy Madagascar and the Comoro Islands, and have adapted to the regions two different climate zones; the rain forest and the dry regions. The rainforests brings on floods, while the dry region in the west brings on drought. The environmental condition in which the lemur has adapted also makes different sets of adaptations. These two extreme sets of weather have created morphological and behavioral varieties amongst the lemur species.
 Lemurs have heterodyne- dentition patterns, meaning that there is more than one single tooth morphology. The tooth patterns of the lemurs vary based on their environment and diet. All lemurs share a common trait of a toothcomb, as well as a dental formula of 2.1.3.3. A toothcomb is the set of bottom incisors and canines, and facing forward instead of up, and are used for such activities such as cutting through tree bark extruding seeds, and grooming. Since they are smaller creatures it could be used as a defense mechanism and to ward off prey.
 The dentition pattern of the lemur has been influenced by the environment due to the fact that they are primarily arboreal, consuming mostly plant material. Their toothcomb is a perfect trait for an animal who consumes fruit and woody plants such as trees, shrubs, and bushes.  I believe the toothcomb is an trait that has adapted and has assisted the lemur survive in its environment.


Spider Monkey (New World Monkey/Platyrrhini)
 Spider moneys inhabit the tropical rain forests from - Peru, Central Mexico, South America and Brazil,. This area reaches from Brazil to Mexico.  Their long limbs and tail help them to navigate through the evergreens which make up the rain forest. They spider monkey prefers areas of the rainforest that are isolated and basically undisturbed..
 The Spider monkey dental formula is as follows - 2.1.3.3 which means the ratio is 2 incisors, 1 canine, 3 premolars and 3 molars, similar to that of a lemur. Spider Monkeys have a total of 36 teeth, which are also smaller in size in comparison to its overall head size.
 The Spider monkeys dentition pattern can be seen as an adaptation to its environment since the 36 teeth help it to eat the fruit and nuts which primarily make up its daily diet. Its sharp canine’s aide in eating and penetrating through hard fruit, and its premolars and molars help the Spider monkey eat hard nuts, chewing them thoroughly.  Both of the above can easily be viewed as adaptations to their given environment.


Baboon (Old World Monkey/Cercopithecidae)
 Baboons are strictly ground dwelling creatures during the day, returning to the trees at night, inhabiting a range of environments: tropical rain forest, shrub land, the wide open savannahs, hills and open woodlands across Africa and Asia. They belong to the Cercopithecoidea superfamily within the Haplorhini suborder of the primate order. They are also found surviving in Gibraltar, south of Spain. Baboons are very social. The smallest group size might have about 50 members, and can easily reach up to 200 plus members.
The Baboons dental formula is as follows - 2.1.2.3 which means they have 2 incisors, 1 canine, 2 premolars and 3 molars. Baboons have long, dog-like muzzles, which house their extremely powerful jaws and two sharp canine teeth. They are omnivorous are known for eating insects, fish, shellfish, hares, birds and small antelopes, but their diet consists of mainly plants.
It is clear to me that their dental pattern has helped them to eat a wide variety of foods which has aided their survival.  Their sharp canines help them penetrate through thick hard foods even though the molars help in the chewing of plant materials, shellfish, and animal meats etc.

Gibbon ((Lessor ape/Hylobatidae)
Gibbons are native to the rain forests of Southeast, South and East Asia which Thailand, China, Cambodia, Vietnam, Laos, Myanmar, Bangladesh, India, Malaysia, and Indonesia. Gibbons are more so compared to humans, living in similar nuclear families, and are monogamous; their communities consist of adults and the offspring, with a gestation period of 7 months. Gibbons rarely go down to the forest floor as they live mainly in the tree tops and are considered arboreal. They are always defending their territory,(much like howler monkeys) against other species with loud whooping and hooting vocalizations. They make their home in the dense rain forests of these areas using their long arms to navigate from tree to tree.
The Gibbons dental formula is as follows - 2.1.2.3 which is similar to that of baboons. This means they have 2 incisors, 1 canine, 2 premolars and 3 molars. This is an ideal combination for the wide variety of food that they like to consume regularly.
 I think it is clear that the dentition pattern helps the baboon to eat a diet consisting of fruit, flowers, young leaves, insects and birds, and, bird eggs.  The primates’ ability to easily adapt to its environment is partly due to Gibbons dentition pattern and its ability to consume a wide variety of foods.

Chimpanzee (Great Ape/Hominidae)
Chimpanzee are found in about 21 African countries from the west coast of the continent to as far east as western Uganda, Rwanda, Burundi and Tanzania, in what is known as the equatorial forest “belt”, tropical forests and bordering in Savannas. They are very social living in communities of about 20 to 150 or so, though they travel in small groups. They rarely live past the age of 50, weighing between 90 and 115 pounds and measure about 4 feet in height Chimpanzees occupy the rain forests, woodlands and grasslands of Africa, primarily Central and West Africa. The Chimpanzee lives in a fission-fusion society: mating being promiscuous. The male Chimpanzee is dominant and has sexual power over the females. The female is basically the procreator role, and the gestation period is 8 months. They walk on all fours but also swing from tree to tree as well as stand and walk upright. And they prefer areas where there are plenty of trees.
The Chimpanzee dental formula is as follows - 2.1.2.3 which is similar to Baboons and Gibbons. This means they have 2 incisors, 1 canine, 2 premolars, and 3 molars. This dentition helps them eat a diet full of fruit, plant, birds and small animals. There sharp canines can also be used by the Chimpanzee in defense of other animals and predators.
I believe it is evident that the Chimpanzee’s teeth have helped it surviving in an environment where it can potentially be attacked by other animals such as lions and tigers. The wide variation of teeth help the Chimpanzee eat a diet filled with a variety of plants and animals.


After researching the specified primates dentition patterns, I have found a slight similarity amongst the all the above. I believe that their environment played a role in developing their dental traits which contributed to their survival.

Thursday, November 6, 2014

Week 3 comparisons

1. Dorsal Fins on shark vs. orca
Sharks are a group of fish characterized by a cartilaginous skeleton, Great whites average 12-16 feet long (3.7-4.9 m) long, weighing about 5,000 pounds. The dorsal fin of a white shark contain dermal fibers that work "like riggings that stabilize a ship's mast", and stiffen dynamically as the shark swims faster to control roll and yaw. The bony or cartilaginous bones that support the base of the dorsal fin in fish are called pterygiophores. The primary hydrodynamic function of this fin is stabilization, preventing the shark's body from rolling uncontrollably and to assist in sudden turns, the dorsal fin is broadly triangular with a short free rear tip and muscular base.

Killer whales are the largest extant members of the dolphin family. Males typically range from 6 to 8 meters. The dorsal fin is tall and triangular. Reaching a height of up to 1.8 m (6 ft.) in a large adult male, it is the tallest dorsal fin of all cetacean. Like the flukes, the dorsal fin is made of dense, fibrous connective tissue, without bones or cartilage. Like the keel of a boat, the dorsal fin may help stabilize a killer whale as it swims at high speeds, but a fin is not essential to a whale’s balance. As in the flukes and the flippers, arteries in the dorsal fin are surrounded by veins to help maintain body temperature.
. Dorsal Fins on shark vs. orca
Sharks are a group of fish characterized by a cartilaginous skeleton, Great whites average 12-16 feet long (3.7-4.9 m) long, weighing about 5,000 pounds. The dorsal fin of a white shark contain dermal fibers that work "like riggings that stabilize a ship's mast", and stiffen dynamically as the shark swims faster to control roll and yaw. The bony or cartilaginous bones that support the base of the dorsal fin in fish are called pterygiophores. The primary hydrodynamic function of this fin is stabilization, preventing the shark's body from rolling uncontrollably and to assist in sudden turns, the dorsal fin isbroadly triangular with a short free rear tip and muscular base.
Killer whales are the largest extant members of the dolphin family. Males typically range from 6 to 8 meters. The dorsal fin is tall and triangular. Reaching a height of up to 1.8 m (6 ft.) in a large adult male, it is the tallest dorsal fin of all cetacean. Like the flukes, the dorsal fin is made of dense, fibrous connective tissue, without bones or cartilage. Like the keel of a boat, the dorsal fin may help stabilize a killer whale as it swims at high speeds, but a fin is not essential to a whale’s balance. As in the flukes and the flippers, arteries in the dorsal fin are surrounded by veins to help maintain body tempature.

                                                            Great White Dorsal fin




2. Human hand vs. dog paw.
 A comparison between a generic four-legged animal, and a human standing on his toes and fingertips.
The bone structure is almost the same. The hand is the multi-fingered extremity at the end of the arm.  It is one means of which humans have changed the world by creating many accomplishments.
The digital and metacarpal pads of a dog paw work as shock absorber s and help protect the bones and joints in the foot. The carpal pads work like brakes, of sorts, and help the dog navigate slippery or steep slopes. Meanwhile, as the paw gets cold when it hits the ground, arteries transfer the chilled blood back to the body where it warms up again. Because of these traits, scientists believe that domestic dogs first evolved in colder environments before spreading out into other climates. The pads also help the dog distinguish between different types of terrain.





                                                  Dog Paw               Human Hand






Thursday, October 30, 2014

Protein Synthesis



DNA
TTTTACCAAGCAATGTGCAGTACTGAACGGCAAGTGGTAAGTGTTAGCTTGATCTTT




By John Kolt

Thursday, October 23, 2014

The most influence that may have affected Charles Darwin's Development of his theory of Natural selection was Alfred Russel Wallace.
  Wallace had started his fascination in collecting species of plants and animals and had taken an interest in the different species of the same and had wondered why there were different of the same. He began on going on expeditions where he acquired more knowledge of his interests.  In 1855, Wallace published a journal suggesting that current species were descendants from other species and that the appearance of new ones was based mainly on environmental factors.  This actually caused others to urge Darwin to publish his own findings, but he hesitated.  Wallace again described evolution as a process driven by competition and natural selection.  Once again when Darwin received Wallace's new paper, Darwin began to wonder that if he were to wait to publish his own findings Wallace would receive all credit, hence the book "Origin of Species".
     Resources being limited, organisms with better access to resources are more successful, in order for natural selection to occur, reproduction of those species are a necessity and in order for traits to evolve, they have to be heritable, and lastly natural selection is a result of the environment.  All of these meaning that Wallace was aware that there is a force which allow certain species to be dominant and that there is a natural order that has to be maintained.  That being said
dominant species will always prevail.  Darwin could not have come up with these conclusions on his own.  He had to have a colloboration of all ideas.  The ideas of the church were not to deter Darwin from publishing his work.  The church was upset that Darwin's ideas were to lead to the undermine of faith, as opposed to the marriage of faith and science.