Thursday, October 30, 2014

Protein Synthesis



DNA
TTTTACCAAGCAATGTGCAGTACTGAACGGCAAGTGGTAAGTGTTAGCTTGATCTTT




By John Kolt

Thursday, October 23, 2014

The most influence that may have affected Charles Darwin's Development of his theory of Natural selection was Alfred Russel Wallace.
  Wallace had started his fascination in collecting species of plants and animals and had taken an interest in the different species of the same and had wondered why there were different of the same. He began on going on expeditions where he acquired more knowledge of his interests.  In 1855, Wallace published a journal suggesting that current species were descendants from other species and that the appearance of new ones was based mainly on environmental factors.  This actually caused others to urge Darwin to publish his own findings, but he hesitated.  Wallace again described evolution as a process driven by competition and natural selection.  Once again when Darwin received Wallace's new paper, Darwin began to wonder that if he were to wait to publish his own findings Wallace would receive all credit, hence the book "Origin of Species".
     Resources being limited, organisms with better access to resources are more successful, in order for natural selection to occur, reproduction of those species are a necessity and in order for traits to evolve, they have to be heritable, and lastly natural selection is a result of the environment.  All of these meaning that Wallace was aware that there is a force which allow certain species to be dominant and that there is a natural order that has to be maintained.  That being said
dominant species will always prevail.  Darwin could not have come up with these conclusions on his own.  He had to have a colloboration of all ideas.  The ideas of the church were not to deter Darwin from publishing his work.  The church was upset that Darwin's ideas were to lead to the undermine of faith, as opposed to the marriage of faith and science.